זיהוי בידוד ואפיון נגיפי קדחת קיקיונית מחרקים מעבירים

 

מחקר מס' 848-0314-05/06


יהודה שטרם, ידין חגי, רובינשטיין-גיני מריסול, קוזנטזובה לריסה וגינזבורג אלכסי.

החטיבה לוירולוגיה, המכון הווטרינרי ע"ש קימרון. ת.ד. 12 בית דגן 50250

 


 

2.2. מבוא ותיאור הבעיהמחלת שלושת הימים (BEF) bovine ephemeral fever היא מחלה קשה של בקר ובופלו. המחלה הנפוצה באזורים טרופיים וסאבטרופיים ונחשבת כבעלת חשיבות כלכלית גדולה בארצות כמו אוסטרליה, יפן, סין ודרום אפריקה. המחלה נגרמת ע"י נגיף השייך למשפחת ה- Rhabdoviridae המועבר ע"י חרקים המשמשים כווקטורים. בשנים האחרונות חדר הנגיף לארץ וגרם לגל התפרצויות. כחלק מהטיפול והתייחסות למחלה בררה עבודה קודמת את מקור הנגיף, מאחר והנגיף יכל להגיע ממקומות שונים כמו דרום אפריקה, דרום מזרח אסיה ואוסטרליה. לשם כך נבדקו בשיטות מולקולריות הקירבה הגנטית של הנגיפים שבודדו בשנים האחרונות עם בידודים מדרום מזרח אסיה ואוסטרליה והוברר שהנגיף שזוהה בארץ דומה מבחינה אבולוציונית לזה של הנגיפים שבודדו בדרום מזרח אסיה.
עצם העובדה שהנגיף מועבר ע"י חרקים פותח את האפשרות החיזוי של התפרצות המחלה. בשימוש בכלים המולקולריים הרגישים שפותחו במעבדה ניתן יהיה בעזרתם לזהות את הנגיף באוספים של חרקים שנאספו בזמן לפני ואחרי התפרצות המחלה. בשימוש בכלים סטטיסטיים אנו מקוים למצוא את קו הייחוס של אחוז החרקים הנושאים שמעליו יש סיכוי גבוהה להתפרצות המחלה ומתחתיו הסיכוי יהיה נמוך. בנוסף לכך זיהוי הנגיף בחרקים יאפשר את בידודו וכמובן את אפיון הנגיף. הכלים שפותחו בשנים האחרונות כתגובה להתפרצות של 1999 ו 2004 כוללים מערכות RT-PCR, מערכת real-time RT-PCR ומערכת שיבוט של הגן G הנגיפי החיונית לבדיקת רצף הבסיסים של הגן G השלם.


2.2.1. רקע מדעי
נגיף קדחת שלושת הימים (BEFV) Bovine ephemeral fever virus גורם למחלה אך ורק בקר ובאפלו מים. למרות דיווחים על מציאת נוגדנים בסוגים שונים של צבאים ואנטילופות באפריקה הנגיף מעולם לא בודד בבעלי-חיים אלו. הנגיף, מועבר ע"י חרקים המשמשים כווקטור, שייך לקבוצת viridaeRhabdo לגנוס Ephemerovirus (., 2000Walker et al(.
בדומה לנגיפי ראבדו אחרים, הגנום של הנגיף הוא חד-גדלי (ssRNA) בכוון השלילי בגודל של 14,900בסיסים ומקודד לחמישה חלבוני מבניים (Walker et al., 1991) (N, P, M, G and L). מספר הגנים הלא מבניים המקודדים ע"י הנגיף הוא גדול ביחס לנגיפים אחרים השייכים לקבוצה זו והם NSG וכן חלבונים קטנים אחרים , b ,g   (תמונה 1)
(Walker et al., 1992; Wang and Walker, 1993; McWilliam et al., 1997).


תמונה 1. מבנה גנום נגיף קדחת שלושת הימים. הגן G מסומן בצבע כתום.


לנגיף ישנה קרבה אנטיגנית לנגיפים כדוגמת Kotonkan virus הגורמים למחלות דמויות מחלת שלושת הימים באפריקה ומלזיה בנוסף לקרבה לנגיפי הבקר לא פתוגניים Kimberly virus, Berrimah virus Adelaide River virus and . השוואת רצפי הבסיסים והחלבון של הגן N בין הנגיפים הללו מראה קירבה בין הנגיפים הללו למרות שהשונות בגן N בנגיפים השונים עולה על 40% (Wang et al., 1995).
המחלה שתוארה לראשונה ב- 1906 בדרום אפריקה מופיעה באזורים טרופיים וסובטרופיים הנמצאים משני צדדיו של קו המשווה הכוללים את אפריקה כולה, אזורים באסיה הנמצאים דרומית לקו הכולל את ישראל, סוריה, עירק, אירן, פקיסטן, הודו, בנגלדש, דרום ומרכז סין, דרום יפן, דרום מזרח אסיה ואוסטרליה. לעומת זאת המחלה לא דווחה מעולם באירופה ואמריקה הדרומית והצפונית. המחלה מופיעה בקיץ והיא מסוגלת לנוע למרחקים גדולים בכוון כללי של התרחקות מקו המשווה.
הנגיף מועבר ע"י חרקים וההנחה המקובלת היא שהוא מועבר בעיקר ע"י סוגים שונים של יתושים St. George 1994; Kirkland P. D 2002; Standfast et al., 1976)). לעומת זאת ניתן היה להראות שהנגיף כנראה לא נמצא בסוגים שונים Culicoides. בניסיונות בידוד שנעשו ב Culicoides שונים שנאספו בדרום אפריקה באזור בו הבקר היה נגוע במחלה לא ניתן היה לבודד את הנגיף כאשר מאותו אוסף בודדו חמישה נגיפים אחרים בהם גם נגיף האקבנה (Theodoridis, et al., 1979). גם בניסיונות האכלה של Culicoides שונים ניתן היה להראות שהחרקים הללו אינם רוכשים את הנגיף באכילה , et al., 2003) (Venter.
לעומת זאת ניתן היה להראות שאין העברה במגע בין בעלי-חיים ועם הפרשות נוזלי גוף ובזרמה. בניסיונות מבוקרים ניתן היה להראות שרק בהזרקה תוך-ורידית ניתן היה לגרום להדבקה לעומת זאת הזרקה תוך-שרירי או תוך-עורמת לא גרמה לתחלואה.
המחלה מופיעה בדרך כלל בסוף האביב עם תחילת הקיץ לאחר תקופת גשמים סוערת. תקופה זו היא התקופה שבה התנאים להופעת מחלות הנגרמות ע"י נגיפים המועברים ע"י וקטורים חרקיים כדוגמת מחלת כחול הלשון המרמז על קשר של העברת המחלה ע"י חרקים.
, et al., 2003; Kirkland P. 2002) (Venter.
מספר גדול של מחלות ארבו מאופיינות בתקופות ארוכות של חוסר פעילות ללא כל עדות להמצאותם כאשר ללא התרעה המחלה פורצת. תופעה רווחת במחלות הללו היא שבדרך כלל ההתפרצויות הן רבות עוצמה. תקופת הזמן בין התפרצות אחת לשניה יכולה להיות במרווחים של עשור או יותר אבל מרווחי הזמן יכולים להיות גם קצרים יותר. דוגמא מובהקת לממצא זה היא ההתפרציות של מחלת שלושת הימים בארץ . במשך 15 השנים האחרונות היתה התפרצות ב 1990 ואחר במרווח של כמעט עשור ב 1999 (Yeruham et al., 2002). לעומת זאת ההתפרצות הבאה היתה במרווח של 5 שנים ב 2004. בדוגמאות שהובאו היתה אכן התפרצות רבת עוצמה מבחינת מספר העדרים ומספר בעלי החיים שנפגעו (Yeruham et al., 2003).
למרות עובדות אלו עיתוי הופעת המחלה נשאר עדיין אניגמתי ובלתי צפוי. מבחינה מעשית תופעה זו היא בעלת משמעות רבה ביותר מאחר ואפידמיה יכולה להתרחש זמן רב לפני הופעת סימני המחלה ללא כל אזהרה. כאשר סימני המחלה מופעים בשלב מאוחר שלא ניתן להפעיל את האמצעים המתאימים לבלימת המחלה. בנוסף לנפיצות הוקטור הנושא את הנגיף כמובן גם מצבו החיסוני והממשק של העדר יש להם השפעה מכרעת על הופעת המחלה.
בבחינה לאחור של התפרציות מחלות ארבו, הוברר הקשר בין ההתפרצות ותנאי מזג האוויר. האקלים בסביבת הגידול של החרקים הוא מרכיב יסודי בהופעת המחלה כאשר לכל חרק יש את הסביבה האקלימית שבה הוא פועל(Woodruff et al., 2002) . כל אחד מהווקטורים פועל במגבלות התנאים האקלימיים המתאימים לו כאשר למזג האוויר בכל סביבה אקלימית יש לה השפעה רחבת טווח על הוקטורים. שינוי קטן יחסית בסביבה האקלימית יכול להיות הרה אסון לגבי כל אחד מהווקטורים.
אין ספק שלמזג האוויר ולמשטר הרוחות בכל אחד מהאזורים הפגועים ישנה השפעה מכרעת על הסיכוי להופעת המחלה כאשר כל ההשפעות הללו באות לידי ביטוי סופי במספר הוקטורים הנושאים את הנגיף כך שמעלים את הסיכוי להתפרצות המחלה.
גורמים אפידמיולוגיים נוספים ובעלי חשיבות גדולה הם תדירות האכילה של הווקטור והיחס המספרי בין הווקטור ובעל החיים. חרקים מוצצי דם ניזונים מבעלי חוליות להספקת חלבונים להתפתחותם, להשלה וגידול מכאן שאכלתם איננה רציפה. האכילה הופכת לרציפה כאשר תהליכים אילו נשלמים. כתוצאה מכך קצב אכילתם הוא קבוע ללא קשר לריכוז החרקים ובעלי החיים. הקשר ווקטור – בקר מבוטא כ Vector/Cattle כפול a שהוא קצב האכלה. מכאן ניתן להסיק שבמידה ואחוז הנשאים יגדל הסיכוי להופעת המחלה גבוהה יותר
Basanez, 1997)).
סימני המחלה האופייניים כוללים שני מופעי עליה בחום במרווח של 12-18 שעות בין שיאי החום וירידה מידית בתנובת החלב. בשלב השני ישנה האצה בקצב הדופק והנשימה, רעד בשרירים, סימני דפרסיה, התקשות שרירים, צליעה, נזלת, הפרשה מרובה של רוק וגודש דמעות. ההחלמה היא בדרך כלל דרמטית ונשלמת ברוב המקרים תוך שלושה ימים. בחלק מהמקרים תנובת החלב חוזרת לרמה של 80-90% מהתנובה המקורית תוך 10 ימים. התחלואה היא בדרך כלל גבהה וחלק גדול מבעלי-החיים הנדבקים רוכשים את המחלה. לעומת זאת התמותה היא נמוכה ומגיעה לרמות של 1-4% אבל יכולה להגיע לרמות של 10-20% בבקר בוגר לבשר וכן ברפתות של פרות בעלות תנובת חלב גבוהה Walker et al., 1991; Nandi and Negi, 1999)).
בשנים האחרונות פותחו שיטות מאפשרות זיהוי DNA ברגישות גבהה יותר בתהליך הנקרא PCR. real-time בשיטה זו מוגבר מקטע הDNA כפי שהוא מוגבר בדרך הרגילה אך לשם זיהוי תוצר הריאקציה משמשים הסמנים הפלורסנטיים כאשר המערכת שפותחה בעבודה קודמת מבוססת על הכימיה של TaqMan (Stram et al., 2004). בנוסף ליכולת הזיהוי הגבהה הזו היא מאפשרת גם כימות מדויק של חומצות גרעין (Quantitive (q)PCR) ע"י יצירת עקומת כיול שניתן ליחס אותה לדוגמא לא ידועה )תמונה (2 (Stram et al., 2004) . בשיטה זו ניתן היה להראות את היכולת לזהות בין 100-10 גנומים של הנגיף.


תמונה 2. רגישות זיהוי נגיף קדחת שלושת הימים כפי שנבדקה בראקציות עם מיהולים עשרוניים של הRNA הנגיפי. NC- negative control


בנוסף פותחו הכלים הדרושים לבדיקות רצף הבסיסים של מירב הגן G הנגיפי. בעזרת הכלים הללו ניתן לשבט מקטע בגודל של כ 1850 בסיסים כיחידה אחת. לאחר השיבוט ניתן בקלות יחסית לברר את רצף הבסיסים שלו. מידע זה של רצף הבסיסים ובעקבותיו רצף חומצות האמינו של החלבון משמשים כבסיס לאנליזה של הקרבה בין הנגיפים.
.2.
A.

B.

C.

תמונה 3. מקומות ותאריכי איסוף החרקים. המספרים מציינים חודשי האיסוף.

A. איסוף סוגים שונים של culicoides

B. איסוף של חרקים אחרים מאלה של ה culicoides

C. תמונת התפרצויות המחלה בשנת 2004.

 

2.3. חומרים ושיטות
הפקת RNA נגיפי מחרקים.
למבחנה המכילה חרקים מוקפאים הוסף 400 l בופר PBS המכיל 10% אנטיביוטיקה ו 10% . bovine fetal serum. בשימוש בעלי המותאם למבחנת אפנדורף. לאחר סירכוז ב 4000RPM למשך 5 דקות נילקח הנוזל העליון. הפקת הפקת ה RNA נעשתה בשתי שיטות. 1 הפקה בשימוש ב TriReagent ובשימוש בקיט להפקת RNA של Qiagen על פי הוראות היצרנים.


תהליך PCR
ריאקצית RT-PCR
הוכן cDNA במערכת המורכבת;
מבופר ריאקציה,
,(10mM Tris-HCl pH. ,8.5 50mM KCl, 10 mM MgCl2)15 U AMV reverse transcriptase Chimerx, USA)10 U RNasine (Promega, USA) ,(, 100 mM מכל אחד מארבעת הבסיסים, 10 ng של שני תחלי הראקציה ומים לנפח סופי של 20  ml.
תנאי הריאקציה היו: 420C ל 30 דקות ואחר 980C ל 5 דקות.


בשלב זה שימשו התחיליים
bef966U AAGRGATTATGCNTATTTATT
bef1579LGCTGTGCTTGTAAACCAACCTAC


Nested PCR
לזיהוי הנגיף נעשה תהליך של Nested PCR המאפשר זיהוי של מספר קטן ביותר של עותקי חומצות גרעין.
התחיליים ששימשו לראקציה הראשונה היו אלה של תהליך ה RT ואלה של הראקציה השניה

היו bef966U AAGRGATTATGCNTATTTATT ו
bef1561 CCTACAACAGCAGATAAAACCTT .
תנאי הראקציה היו 940C ל 40 sec, 550C ל 40 sec ו 720C ל 50 sec ל 35 סיבובי ראקציה. תנאי המחזור השני של התהליך היה דומה לזה של הראשון פרט לכך שנערכו 20 מחזורים ולא 35.


ריאקצית real-time RT-qPCR
תהליך שלב ה RT היה דומה לזה שתואר פרק של "הפקת RNA וראקצית ."RT-PCR  לתהליך ה qPCRנלקחו 2 mlמה cDNAשהוכן למערכת ריאקציה המכילה;
12.5 lתערובת ריאקציה 100 ng ,(Eurogentec, Belgium)מכל אחד מהתחליים, 10 pgשל הגלאי ומים לנפח סופי של .25 lתנאי הריאקציה היו 500C למשך 2 דקות, 950Cלמשך 10 דקות ואחר 35סיבובים של 950Cלמשך 15שניות ו 600Cלמשך דקה. כל העיבודים נעשו בתוכנת Prism 7000 (Applied Biosystems, USA).


התחיליים היו
Bef83f, GAGATCAAATGTCCACAACGTTTAA
Bef155R AATGTTCATCCTTTGCAAGATTATGA


הגלאי היה
AATTATCACTTCAAGCCC בעמדה 111-128 ה מסומן ב 6-carboxy-fluorescein (FAM)


.2.4 תוצאות
השלב הראשון בעבודה זו היתה לבדוק מי משיטות הפקת ה RNA היא היעילה ביותר לשם כך הוסף נגיף למבחנות של חרקים קפואים. הוכן תסנין מהחרקים כפי שפורט בחומרים ושיטות, חלקו נלקח להפקת ה RNA בשימוש בקיט הפקת RNA וחלקו נלקח להפקה ב TriReagent. לאחר ההפקה נבדקה נוכחות ה RNA הנגיפי במערכת של real-time PCR, ניתן לראות שהפקתTriReagent היתה יעילה יותר (תמונה 3). למרות שניתן להשתמש בהפקה השניה.


תמונה 4. השוואת יעילות הפקת RNA מחרקים. לאחר מיצוי חרקים נעשתה הפקת RNA בשימוש בערכות .A. TriReagent ו B. Qaigen. הביקורת השלילית


בהמשך העבודה הפקת ה RNA נעשתה בשתי השיטות. שתי השיטות לבידוד הנגיף יכולות להיות ישימות לבדיקת נוכחות הנגיף מאחר ושיטת הזיהוי (nested PCR) הינה רגישה ביותר בהמשך העבודה שתי השיטות שימשו להפקת ה RNA.
לשם זיהוי הנגיף נבדקו א. מאגרים קימים של חרקים הן במכון הווטרינרי והן מאגרים שנאספו לעבודה זו. כפי שמופיע בטבלה 1.
נבדקו 38,096 חרקים ובאף מאגר לא נמצא הנגיף נבדקו חרקים שנאספו בשנים 2003 ו2004 השנים שהיו רלבנטיים לגבי ההתפרצות המחלה. המאגרים שנאספו היו בעיקר מאזורים שבהם הופיע המחלה בבקעת הירדן לאורך מישור החוף עם דגש על החלק הדרומי של המישור. בכמה דוגמאות שנבדקו נראה היה שהיתה ראקציה חיובית (תמונה A5). כל הדוגמאות החיוביות נבדקו פעם שניה בכדי לאושש את הקביעה הראשונה ובכולם התוצאה החיובית לא חזרה (תמונה 5A).


תמונה 5. דוגמא של ראקצית nested PCR לזיהוי הנגיף. ההפקה והראקציה כפי שצוין בפרק חומרים ושיטות. A. נראה שבעמודה 9 ישנה ראקציה חיובית דוגמה 448. כאשר נעשתה ראקציה נוספת, B עמודה 14, הראקציה היתה שלילית.


טבלה 1
רשימת החרקים מיקום ותאריך הלכידה.



לנסות ולהתמקד בחיפוש אחר הנגיף התמקדה עבודה במשק עין צורים אשר בתאריך סססס נמצאה פרה חיובית לנגיף. נאספו דוגמאות של חרקים במשק בתאריכים קרובים למציאת הפרה המודבקת.

 


נבדקו יותר מאלפיים חרקים שונים שנלכדו תקופה קצרה לאחר זיהוי הנגיף בניסיון ללכוד אותו. הבדיקה שנעשתה לא הראתה נוכחות של הנגיף. דוגמא אחת של St. calcintraus הראתה ראקציה חיובית.


תמונה 6. בדיקת PCR לנוכחות נגיף ה bef ב לכידה של St. calcintraut. נעשתה ראקצית nested PCR כפי שצוין בחומרים ושיטות. 1. חרקים. 2. ביקורת חיובית. 3. ביקורת שלילית. M. סמן לגודל. החץ מציין מיקום הקו החיובי של הנגיף.


חזרה נוספת של הראקציה היתה גם היא חיובית. בכדי לאשש סופית את הממצא הזה הדוגמא נילקחה להפקת RNA חדשה בתנאים נקיים הטובים האפשריים ביותר, לצערנו הוברר שהדוגמא היא שלילית לנוכחות הנגיף.


2.5 דיון
התוצאות המוצגות כאן מראות שבדוגמאות שנבדקו לא נמצא הנגיף למרות שנבדקו כ 40,000 חרקים נאספו בין השנים 2003-2006. הדוגמאות שנבדקו נלקחו מאזורים בהם נפגעו עדרים מהמחלה. אזורים אלו משתרעים מבקעת הירדן מישור החוף והערבה בה היה אירוע.
חלק מהספריות ששימשו לעבודה זו הם ספריות חרקים שנאספו עבור זיהוי נגיף הנילוס המערבי. בהחלט יתכן והחרקים שנבדקו אינם אלה הוקטורים המעבירים ויש לחפש מועמדים אחרים שיכולים לשמש כמעבירים
בשבועות האחרונים הופיעה המחלה (עין צורים) ואכן נעשו לכידות יזומות במשק וגם בלכידות אלה לא הצלחנו להראות את נוכחות הנגיף פרט לדוגמא אחת אשר הראתה סימנים של נוכחות הנגיף אשר בניסיונות ביקורת הוברר שהיתה שגויה.
התוצאה הזו אף על פי שהיא לכאורה מאכזבת משום שאיננה מספקת מידע מי הוא המעביר של הנגיף בארץ ואולי בעולם מאפשרת הצצה לקושי במציאת המעביר של הנגיף. הממצא שמובא בעבודה זו היא בהתאמה עם ממצאים אחרים ברחבי העולם בהם ישנו קושי גדול במציאת וקטור הנושא את הנגיף. יש להניח שדרוש מדגם גדול בהרבה מזה שנעשה (למרות גודלו של המדגם למעלה מ 40,000) בעבודה זו המרמז שרק נישא על ידי מספר קטן ביותר של חרקים או שמחזור הנשיאה של הוא קצר ביותר ויש למצא את התנאים או הזמן המתאימים למציאת חרקים נשאים
(Theodoridis, et al., 1979). בעבודה זו שפורסמה ב 1979 המחברים מדווחים שלא הצליחו לבודד את הנגיף מקולוקואידים שנלכדו ברפתות בהן אובחנה המחלה, למרות שלמספר קוליקואדים יוחסה היכולת לשמש כווקטורים של הנגיף. כמו כן הם דווחו שהצליחו לבודד נגיפים אירים מאותן דוגמאות. דוגמא נוספת לקושי בזיהוי הנגיף ישירות מחרקים תואר בהקשר Reticuloendotheliosis virus (REV) Davidson & Braverman, 2005)( ורק ניסיונות האכלה והדבקה אפשרו לקבוע שלזבובי הבית יש כנראה מעורבות בהעברת הנגיף.
כך ניסיונות אלה מדגישים את הקוי בבידוד וקושי זה בא לידי ביטוי כפי שצוין בהקדמה שעדיין אין הסכמה מי מהווקטורים הוא המעביר העיקרי או אפילו המשני של הנגיף והגורם להופעת המחלה.

 2.6. References


Basanez, G. Maria, Population of vector-borne microparasites. In, Modern approaches of the epidemiology and control of infectious disease 1997. Oxforf University.
David D, Yakobson B, Smith JS, Stram Y. Molecular epidemiology of rabies virus isolates from Israel and other Middle-and Near-Eastern countries J. Clin. Microbiol. 2000, 38: 755-762.
Davidson I and Braverman, Y. Insect Contribution to Horizontal Transmission of
Reticuloendotheliosis virus Journal of Medical Entomology 2005, 42, 128–133.
Kirkland P. D. Akabane and bovine ephemeral fever virus infections Vet. Clin. North Am. Food Anim. Pract.. 2002 18, 501-514.
McWilliam SM, Kongsuwan K, Cowley JA, Byrne KA, Walker PJ. Genome organization and transcription strategy in the complex GNS-L intergenic region of bovine ephemeral fever rhabdovirus. J. Gen. Virol. 1997, 78: 1309-1317.
Nandi S, Negi B. S. Bovine ephemeral fever. Comp. Immunol. Microbiol. Infect. Dis. 1999 22, 81-91
.
Pearson, W. R., (1998) Empirical statistical estimates for sequence similarity scores J. Mol. Biol. 276:71-84
St. George TD. 1994. Ephemeral Fever. In Diseases of Livestock in Southern Africa, J.A.W. Coetzer, G.R. Thomson, and R. C. Tustin, eds. Cape town: Oxford University Press.
Stram Y, Schori D, Chinitch Y, David D, Molad T, Samina I. Molecular characterization of unassigned Israeli Newcastle disease virus (NDV) isolate. Avian Dis. 1999, 42: 746-751.
Stram Y, Chai D, Fawzy HE-D, Molad T, Meiri N, Van-Ham M, El-Kilani S. Fahamy F, Moussa AAM. And Yadin H. Molecular Epidemiology of foot-and-mouth disease (FMD) in Israel in 1994 and in other Middle-Eastern countries in the years 1992-1994. 1995, Arch. Virol. 140: 1791-1798.
Stram Y, Kuznetzova L, Guini M, Rogel A, Meirom R, Chai D, Yadin H, Brenner J.
Detection and quantitation of akabane and aino viruses by multiplex real-time
reverse-transcriptase PCR. J. Virol Methods. 2004,116: 147-154.
Stram Y (b), Brenner J, Braverman Y, Banet-Noach C, Kuznetzova L, Ginni M. Akabane virus in Israel: a new virus lineage. Virus Res. 2004, 104: 93-97.
Standfast HA, St. George TD, and Dyce A. L. The isolation of ephemeral fever virus from mosquitoes in Australia 1976. Aust. Vet. J. 52: 242.
Theodoridis A, Nevill EM, Els HJ, Boshoff ST. Viruses isolated from Culicoides midges in South Africa during unsuccessful attempts to isolate bovine ephemeral fever virus. Onderstepoort J Vet Res. 1979 46:191-198
Walker PJ, Byrne KA, Cybinski DH, Doolan DL Wang YH. Proteins of bovine ephemeral fever virus. J. Gen Virol. 1991, 72: 67-74.
Walker PJ, Byrne KA, Riding GA, Cowley JA, Wang Y, McWilliam S. The genome of bovine ephemeral fever rhabdovirus contains two related glycoprotein genes. Virology. 1992, 191: 49-61.
Walker PJ, Benmansour. A., Dietzgen, R.G., et al., 2000. Rhabdoviridae, In: VanReginmortel, M.V.H., Fauquet. C.M. Bishop, D.H.L, et al. (Eds), Virus Acadeinic Press. New York.
Wang Y, Walker PJ. Adelaide River Rhabdovirus expresses consecutive glycoprotein genes as polycistronic mRNAs: new evidence of gene duplication as an evolutionary process. Virology. 1993, 195: 719-731.
Wang Y, Cowley JA, Walker PJ. Adelaide River virus nucleoprotein gene: analysis of phylogenetic relationships of ephemeroviruses and other rhabdoviruses . J. Gen. Virol 1995, 76: 995-999.
Woodruff RE, Guest CS, Garner MG, Becker N, Lindesay J, Carvan T, Ebi K. Predicting Ross River virus epidemics from regional weather data. Epidemiology. 2002, 13:384-93.
Venter GJ, Hamblin C, Paweska JT. Determination of the oral susceptibility of South African livestock-associated biting midges, Culicoides species, to bovine ephemeral fever virus. Med Vet Entomol. 2003 7:133-137.
Yeruham I, Van Ham M, Bar D, Yadin H, Tiomkin D. Economic aspects of the 1999 outbreak of bovine ephemeral fever in dairy cattle herds in the Jordan Valley in Israel. Vet Rec. 2003, 153:180-182.
Yeruham I, Braverman Y, Yadin H, Van Ham M, Chai D, Tiomkin D, Frank D. Epidemiological investigations of outbreaks of bovine ephemeral fever in Israel. Vet Rec. 2002, 151:117-21.
Davidson I and Braverman, Y. Insect Contribution to Horizontal Transmission of
Reticuloendotheliosis virus Journal of Medical Entomology 2005, 42, 128–133.

לכל המבזקים....
office@milk.org.il פקס: 972-3-9564766 טל: 972-3-9564750 דרך החורש 4 , ת"ד 97, יהוד 5647003
מופעל באמצעות מעוף - מגוון אפקט